Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human STAT3 shRNA Ad5 Particle (Silencing)
Cat. No.:
V0126XX109
Species:
Human
Target Gene:
STAT3
Vector System:
Adenovirus
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX109-1 | CTCAGAGGATCCCGGAAATTT | CDS | Inquiry |
| V0126XX109-2 | GGCGTCCAGTTCACTACTAAA | CDS | Inquiry |
| V0126XX109-3 | CATCTGAAACTACTAACTTTG | 3' UTR | Inquiry |
| V0126XX109-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human STAT3 shRNA Ad5 Particle (Silencing) targets STAT3, a downstream mediator of leptin signaling in the hypothalamus. By specifically reducing STAT3 expression via optimized shRNA, researchers can model leptin resistance and its impact on energy homeostasis. To ensure experimental success, we conduct exhaustive quality control on every preparation, including high-sensitivity titer assays and sequence checks.
Production Cell Line:
HEK293
Viral Backbone:
Adenovirus type 5 (dE1/E3)
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test:
This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test:
This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC:
Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage:
Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability:
This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition:
All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes:
Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.
Target Profile
Gene Name:
STAT3
Full Name:
Signal transducer and activator of transcription 3
Gene Symbol:
APRF; HIES; ADMIO; ADMIO1
Gene ID:
6774
RefSeq ID-1:
NP_001356441.1
RefSeq ID-2:
NM_001369512.1
Summary:
STAT3 is a transcription factor that transmits signals from cytokines and growth factors (such as leptin and IL-6) from the cell surface to the nucleus. Once phosphorylated, it activates genes that regulate cell growth, survival, and inflammation. In metabolic biology, STAT3 is the central effector of leptin signaling in the brain; disruptions in this pathway prevent the brain from sensing fat stores, resulting in uncontrollable hunger and severe obesity.
Related Products
-
AdipoUpX™ Human IFT27 Ad5 Particle (Overexpression)
-
AdipoUpX™ Human SLC27A4 Ad5 Particle (Overexpression)
-
AdipoUpX™ Human IL13 Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human FBP1 shRNA Ad5 Particle (Silencing)
-
LipoKnoxa™ Human NPY shRNA Ad5 Particle (Silencing)
-
LipoKnoxa™ Human VPS13B shRNA Ad5 Particle (Silencing)