LipoKnoxa™ Human PDK4 shRNA Ad5 Particle (Silencing)

Cat. No.: V0126XX170

Species: Human

Target Gene: PDK4

Vector System: Adenovirus

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human PDK4 shRNA Ad5 Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX170-1	CCCGTGTCAATTAACATTTAA	3' UTR	Inquiry
V0126XX170-2	GTTCGAAATAGACACCATAAT	CDS	Inquiry
V0126XX170-3	GTGCAAGACTACAGGAGTTAA	3' UTR	Inquiry
V0126XX170-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human PDK4 shRNA Ad5 Particle (Silencing) targets PDK4, an enzyme that inhibits the pyruvate dehydrogenase complex to conserve glucose in favor of fatty acid oxidation. Silencing PDK4 is vital for exploring metabolic flexibility and the shift in fuel preference in skeletal muscle during weight gain. Our customizable platform ensures reliability through stringent QC, verifying functional titers, sequence accuracy, and microbial safety for every batch produced.

Production Cell Line: HEK293

Viral Backbone: Adenovirus type 5 (dE1/E3)

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.

Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.

Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.

Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.

Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.

Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.

Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.

Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: PDK4

Full Name: Pyruvate dehydrogenase kinase 4

Gene ID: 5166

RefSeq ID-1: NP_002603.1

RefSeq ID-2: NM_002612.4

Summary: PDK4 acts as a metabolic gatekeeper in the mitochondria. It inhibits the usage of glucose as fuel, forcing the body to rely on fatty acids. During metabolic stress or obesity, PDK4 expression rises, which contributes to the "metabolic inflexibility" seen in diabetic patients who can no longer efficiently switch between burning sugar and burning fat.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out