Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human PCSK1 shRNA Ad5 Particle (Silencing)

Cat. No.: V0126XX12
Species: Human
Target Gene: PCSK1
Vector System: Adenovirus
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human PCSK1 shRNA Ad5 Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX12-1 AGTGGAATCACACGGACATTT CDS Inquiry
V0126XX12-2 CTCTTACAGCAGCGGAGATTA CDS Inquiry
V0126XX12-3 TACGGGCAAAGGAGTTGTTAT CDS Inquiry
V0126XX12-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human PCSK1 shRNA Ad5 Particle (Silencing) is a high-performance knockdown tool developed to inhibit PCSK1, an enzyme vital for processing pro-hormones like insulin and POMC. Utilizing a robust U6 or miR30-driven shRNA system, this product allows researchers to explore how PCSK1 deficiency leads to severe early-onset obesity and endocrine disorders. Our platform ensures experimental safety and data integrity through comprehensive QC, including high-precision functional titering and negative results for both sterility and mycoplasma.
Production Cell Line: HEK293
Viral Backbone: Adenovirus type 5 (dE1/E3)
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: PCSK1
Full Name: Proprotein convertase subtilisin/kexin type 1
Gene Symbol: PC1; PC3; NEC1; SPC3; PC1/3; BMIQ12
Gene ID: 5122
RefSeq ID-1: NP_000430.3
RefSeq ID-2: NM_000439.4
Summary: The PCSK1 gene is the blueprint for Proprotein Convertase 1/3 (PC1/3), a central protease in the secretory pathway of neuroendocrine cells. PC1/3 is essential for post-translational modification, undergoing complex autocatalytic cleavage in the ER and dense core granules to become fully activated. Its primary role is the proteolytic maturation of polypeptide hormones and neuropeptide precursors (e.g., pro-opiomelanocortin) at specific basic residue sites. Failure of this process, often due to PCSK1 mutations, leads to profound hormonal imbalances, manifesting clinically as severe obesity susceptibility and Proprotein Convertase 1/3 deficiency.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.