Inquiry
Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human NTRK2 shRNA AAV Particle (Silencing)

Cat. No.: V0126XX229
Species: Human
Target Gene: NTRK2
Vector System: AAV
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human NTRK2 shRNA AAV Particle (Silencing)
INQUIRY Datasheet MSDS
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. AAV Serotype Tissue Tropism TargetSeq Region Inquiry
V0126XX229-1 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle GCTATTTGAATGGTCAGATAT 3' UTR Inquiry
V0126XX229-2 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CCTTAAGGATAACTAACATTT CDS Inquiry
V0126XX229-3 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle TCCTGGTGGGCAATCCATTTA CDS Inquiry
V0126XX229-4 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle GCTATTTGAATGGTCAGATAT 3' UTR Inquiry
V0126XX229-5 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CCTTAAGGATAACTAACATTT CDS Inquiry
V0126XX229-6 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle TCCTGGTGGGCAATCCATTTA CDS Inquiry
V0126XX229-7 AAV3 Lung; Liver; Smooth muscle GCTATTTGAATGGTCAGATAT 3' UTR Inquiry
V0126XX229-8 AAV3 Lung; Liver; Smooth muscle CCTTAAGGATAACTAACATTT CDS Inquiry
V0126XX229-9 AAV3 Lung; Liver; Smooth muscle TCCTGGTGGGCAATCCATTTA CDS Inquiry
V0126XX229-10 AAV4 CNS; Retina; Heart; Lung; Kidney GCTATTTGAATGGTCAGATAT 3' UTR Inquiry
V0126XX229-11 AAV4 CNS; Retina; Heart; Lung; Kidney CCTTAAGGATAACTAACATTT CDS Inquiry
V0126XX229-12 AAV4 CNS; Retina; Heart; Lung; Kidney TCCTGGTGGGCAATCCATTTA CDS Inquiry
V0126XX229-13 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle GCTATTTGAATGGTCAGATAT 3' UTR Inquiry
V0126XX229-14 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CCTTAAGGATAACTAACATTT CDS Inquiry
V0126XX229-15 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle TCCTGGTGGGCAATCCATTTA CDS Inquiry
V0126XX229-16 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle GCTATTTGAATGGTCAGATAT 3' UTR Inquiry
V0126XX229-17 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CCTTAAGGATAACTAACATTT CDS Inquiry
V0126XX229-18 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle TCCTGGTGGGCAATCCATTTA CDS Inquiry
V0126XX229-19 AAV7 CNS; Brain; Retina; Liver; Smooth muscle GCTATTTGAATGGTCAGATAT 3' UTR Inquiry
V0126XX229-20 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CCTTAAGGATAACTAACATTT CDS Inquiry
V0126XX229-21 AAV7 CNS; Brain; Retina; Liver; Smooth muscle TCCTGGTGGGCAATCCATTTA CDS Inquiry
V0126XX229-22 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle GCTATTTGAATGGTCAGATAT 3' UTR Inquiry
V0126XX229-23 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CCTTAAGGATAACTAACATTT CDS Inquiry
V0126XX229-24 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle TCCTGGTGGGCAATCCATTTA CDS Inquiry
V0126XX229-25 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle GCTATTTGAATGGTCAGATAT 3' UTR Inquiry
V0126XX229-26 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CCTTAAGGATAACTAACATTT CDS Inquiry
V0126XX229-27 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle TCCTGGTGGGCAATCCATTTA CDS Inquiry
V0126XX229-28 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human NTRK2 shRNA AAV Particle (Silencing) is engineered to silence the TrkB receptor, the primary mediator of BDNF signaling in satiety control. Our system provides two distinct expression strategies: high-potency U6-driven shRNA and physiologically optimized miR30-based shRNA for reduced toxicity. To ensure optimal tissue-specific tropism, multiple AAV serotypes are provided. Each batch is subjected to comprehensive quality control—including functional titer, sequence integrity, and sterility—providing a secure and high-performing gene-silencing solution for neuro-metabolic research.
Production Cell Line: HEK293
AAV ITR: AAV2 ITR
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: The sequence identity and genomic integrity of all preparations were successfully confirmed via sequencing and PCR validation.
Sterility Test: Stringent QC assays have verified the sterility of this product lot, ensuring it is free of all detectable microbial contaminants.
Mycoplasma Test: Confirmed free of mycoplasma contamination via high-sensitivity QC assays; this product lot has successfully passed the production safety protocols.
Other QC: Tailored supplementary testing and transduction performance assays are available to evaluate gene silencing at the molecular level. We provide comprehensive in vitro and in vivo assessments to elucidate the impact of shRNA-targeted editing on gene expression profiles and downstream biological phenotypes.
Storage: To maintain optimal viral potency and structural integrity, it is essential to store the vector at -80°C immediately following its receipt.
Stability: Long-term storage at -80°C ensures product integrity for up to 24 months. For immediate experimental use, the thawed viral preparations are refrigerated at 4°C, maintaining robust performance for a period of 2–3 weeks.
Shipping Condition: Shipped on dry ice. Product integrity is guaranteed through temperature-controlled logistics for all viral vector types.
Handling Notes: To prevent titer loss caused by repeated freeze-thaw cycles, we recommend aliquoting the virus into single-use volumes upon receipt. Use low-protein-binding microcentrifuge tubes and store under specified conditions. Strict adherence to biosafety protocols is required; perform all handling within a designated biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: All products undergo stringent quality control; however, no warranty is provided for performance in specific applications, given the diversity of experimental variables. The user is ultimately responsible for ensuring proper storage, handling, and adherence to all local laws, biosafety standards, and safety regulations throughout the use of the product.

Target Profile

Gene Name: NTRK2
Full Name: Neurotrophic receptor tyrosine kinase 2
Gene Symbol: OBHD; TRKB; DEE58; trk-B; EIEE58; GP145-TrkB
Gene ID: 4915
RefSeq ID-1: NP_001007098.1
RefSeq ID-2: NM_001007097.3
Summary: NTRK2 encodes a receptor tyrosine kinase of the neurotrophic tyrosine receptor family that mediates signaling in response to neurotrophin binding. Upon activation, the receptor undergoes autophosphorylation and initiates downstream signaling cascades, including the MAPK pathway, promoting neuronal differentiation and survival. Genetic variants in NTRK2 have been linked to obesity and neuropsychiatric disorders, reflecting its role in central nervous system regulation of energy balance. Multiple transcript variants arise from alternative splicing.

Related Products

Inquiry
0
Inquiry Basket

Recognizing the multifaceted nature of obesity, we leverage our expertise in preclinical research to provide tailored solutions that address the unique challenges faced by our partners in the biotechnology and pharmaceutical industries.

By Molecule Type

By Products

By Services

Contact Us

Copyright © Protheragen. All rights reserves.