Inquiry
Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human MYT1L shRNA AAV Particle (Silencing)

Cat. No.: V0126XX298
Species: Human
Target Gene: MYT1L
Vector System: AAV
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human MYT1L shRNA AAV Particle (Silencing)
INQUIRY Datasheet MSDS
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. AAV Serotype Tissue Tropism TargetSeq Region Inquiry
V0126XX298-1 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle GCAGCAAGACAGTAGAAATAT CDS Inquiry
V0126XX298-2 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CGTGACTACTTTGACGGAAAT CDS Inquiry
V0126XX298-3 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CGAAAGCCATTTGCCGTGAAA CDS Inquiry
V0126XX298-4 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle GCAGCAAGACAGTAGAAATAT CDS Inquiry
V0126XX298-5 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CGTGACTACTTTGACGGAAAT CDS Inquiry
V0126XX298-6 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CGAAAGCCATTTGCCGTGAAA CDS Inquiry
V0126XX298-7 AAV3 Lung; Liver; Smooth muscle GCAGCAAGACAGTAGAAATAT CDS Inquiry
V0126XX298-8 AAV3 Lung; Liver; Smooth muscle CGTGACTACTTTGACGGAAAT CDS Inquiry
V0126XX298-9 AAV3 Lung; Liver; Smooth muscle CGAAAGCCATTTGCCGTGAAA CDS Inquiry
V0126XX298-10 AAV4 CNS; Retina; Heart; Lung; Kidney GCAGCAAGACAGTAGAAATAT CDS Inquiry
V0126XX298-11 AAV4 CNS; Retina; Heart; Lung; Kidney CGTGACTACTTTGACGGAAAT CDS Inquiry
V0126XX298-12 AAV4 CNS; Retina; Heart; Lung; Kidney CGAAAGCCATTTGCCGTGAAA CDS Inquiry
V0126XX298-13 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle GCAGCAAGACAGTAGAAATAT CDS Inquiry
V0126XX298-14 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CGTGACTACTTTGACGGAAAT CDS Inquiry
V0126XX298-15 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CGAAAGCCATTTGCCGTGAAA CDS Inquiry
V0126XX298-16 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle GCAGCAAGACAGTAGAAATAT CDS Inquiry
V0126XX298-17 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CGTGACTACTTTGACGGAAAT CDS Inquiry
V0126XX298-18 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CGAAAGCCATTTGCCGTGAAA CDS Inquiry
V0126XX298-19 AAV7 CNS; Brain; Retina; Liver; Smooth muscle GCAGCAAGACAGTAGAAATAT CDS Inquiry
V0126XX298-20 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CGTGACTACTTTGACGGAAAT CDS Inquiry
V0126XX298-21 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CGAAAGCCATTTGCCGTGAAA CDS Inquiry
V0126XX298-22 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle GCAGCAAGACAGTAGAAATAT CDS Inquiry
V0126XX298-23 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CGTGACTACTTTGACGGAAAT CDS Inquiry
V0126XX298-24 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CGAAAGCCATTTGCCGTGAAA CDS Inquiry
V0126XX298-25 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle GCAGCAAGACAGTAGAAATAT CDS Inquiry
V0126XX298-26 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CGTGACTACTTTGACGGAAAT CDS Inquiry
V0126XX298-27 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CGAAAGCCATTTGCCGTGAAA CDS Inquiry
V0126XX298-28 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human MYT1L shRNA AAV Particle (Silencing) targets a transcription factor essential for neuronal differentiation and associated with obesity-related developmental delay. By utilizing optimized U6 and miR30-based shRNA delivery, this tool assists in uncovering the neuronal control of appetite. Our system offers multiple AAV serotypes to ensure optimal tissue-specific tropism. Comprehensive quality control, including high-precision titering and sterility testing, is performed on all particles to ensure experimental reproducibility.
Production Cell Line: HEK293
AAV ITR: AAV2 ITR
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: The sequence identity and genomic integrity of all preparations were successfully confirmed via sequencing and PCR validation.
Sterility Test: Stringent QC assays have verified the sterility of this product lot, ensuring it is free of all detectable microbial contaminants.
Mycoplasma Test: Confirmed free of mycoplasma contamination via high-sensitivity QC assays; this product lot has successfully passed the production safety protocols.
Other QC: Tailored supplementary testing and transduction performance assays are available to evaluate gene silencing at the molecular level. We provide comprehensive in vitro and in vivo assessments to elucidate the impact of shRNA-targeted editing on gene expression profiles and downstream biological phenotypes.
Storage: To maintain optimal viral potency and structural integrity, it is essential to store the vector at -80°C immediately following its receipt.
Stability: Long-term storage at -80°C ensures product integrity for up to 24 months. For immediate experimental use, the thawed viral preparations are refrigerated at 4°C, maintaining robust performance for a period of 2–3 weeks.
Shipping Condition: Shipped on dry ice. Product integrity is guaranteed through temperature-controlled logistics for all viral vector types.
Handling Notes: To prevent titer loss caused by repeated freeze-thaw cycles, we recommend aliquoting the virus into single-use volumes upon receipt. Use low-protein-binding microcentrifuge tubes and store under specified conditions. Strict adherence to biosafety protocols is required; perform all handling within a designated biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: All products undergo stringent quality control; however, no warranty is provided for performance in specific applications, given the diversity of experimental variables. The user is ultimately responsible for ensuring proper storage, handling, and adherence to all local laws, biosafety standards, and safety regulations throughout the use of the product.

Target Profile

Gene Name: MYT1L
Full Name: Myelin transcription factor 1 like
Gene Symbol: NZF1; MRD39; myT1-L; ZC2H2C2; ZC2HC4B
Gene ID: 23040
RefSeq ID-1: NP_001289981.1
RefSeq ID-2: NM_001303052.2
Summary: MYT1L is a neuronal-specific transcription factor belonging to the zinc finger superfamily. It is a powerful driver of neurodevelopment, capable of reprogramming fibroblasts into functional neurons. In clinical settings, mutations in MYT1L are associated with a syndrome involving intellectual disability and early-onset obesity, highlighting the gene's essential role in the hypothalamic circuits that govern appetite and weight control.

Related Products

Inquiry
0
Inquiry Basket

Recognizing the multifaceted nature of obesity, we leverage our expertise in preclinical research to provide tailored solutions that address the unique challenges faced by our partners in the biotechnology and pharmaceutical industries.

By Molecule Type

By Products

By Services

Contact Us

Copyright © Protheragen. All rights reserves.