Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human KCNJ11 shRNA AAV Particle (Silencing)

Cat. No.: V0126XX280
Species: Human
Target Gene: KCNJ11
Vector System: AAV
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human KCNJ11 shRNA AAV Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. AAV Serotype Tissue Tropism TargetSeq Region Inquiry
V0126XX280-1 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle AGTTTGGCAACACCGTCAAAG CDS Inquiry
V0126XX280-2 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle TGATCATCTACCATGTCATTG CDS Inquiry
V0126XX280-3 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle GCCCGCTTTGTGTCCAAGAAA CDS Inquiry
V0126XX280-4 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle AGTTTGGCAACACCGTCAAAG CDS Inquiry
V0126XX280-5 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle TGATCATCTACCATGTCATTG CDS Inquiry
V0126XX280-6 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle GCCCGCTTTGTGTCCAAGAAA CDS Inquiry
V0126XX280-7 AAV3 Lung; Liver; Smooth muscle AGTTTGGCAACACCGTCAAAG CDS Inquiry
V0126XX280-8 AAV3 Lung; Liver; Smooth muscle TGATCATCTACCATGTCATTG CDS Inquiry
V0126XX280-9 AAV3 Lung; Liver; Smooth muscle GCCCGCTTTGTGTCCAAGAAA CDS Inquiry
V0126XX280-10 AAV4 CNS; Retina; Heart; Lung; Kidney AGTTTGGCAACACCGTCAAAG CDS Inquiry
V0126XX280-11 AAV4 CNS; Retina; Heart; Lung; Kidney TGATCATCTACCATGTCATTG CDS Inquiry
V0126XX280-12 AAV4 CNS; Retina; Heart; Lung; Kidney GCCCGCTTTGTGTCCAAGAAA CDS Inquiry
V0126XX280-13 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle AGTTTGGCAACACCGTCAAAG CDS Inquiry
V0126XX280-14 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle TGATCATCTACCATGTCATTG CDS Inquiry
V0126XX280-15 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle GCCCGCTTTGTGTCCAAGAAA CDS Inquiry
V0126XX280-16 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle AGTTTGGCAACACCGTCAAAG CDS Inquiry
V0126XX280-17 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle TGATCATCTACCATGTCATTG CDS Inquiry
V0126XX280-18 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle GCCCGCTTTGTGTCCAAGAAA CDS Inquiry
V0126XX280-19 AAV7 CNS; Brain; Retina; Liver; Smooth muscle AGTTTGGCAACACCGTCAAAG CDS Inquiry
V0126XX280-20 AAV7 CNS; Brain; Retina; Liver; Smooth muscle TGATCATCTACCATGTCATTG CDS Inquiry
V0126XX280-21 AAV7 CNS; Brain; Retina; Liver; Smooth muscle GCCCGCTTTGTGTCCAAGAAA CDS Inquiry
V0126XX280-22 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle AGTTTGGCAACACCGTCAAAG CDS Inquiry
V0126XX280-23 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle TGATCATCTACCATGTCATTG CDS Inquiry
V0126XX280-24 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle GCCCGCTTTGTGTCCAAGAAA CDS Inquiry
V0126XX280-25 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle AGTTTGGCAACACCGTCAAAG CDS Inquiry
V0126XX280-26 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle TGATCATCTACCATGTCATTG CDS Inquiry
V0126XX280-27 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle GCCCGCTTTGTGTCCAAGAAA CDS Inquiry
V0126XX280-28 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human KCNJ11 shRNA AAV Particle (Silencing) targets the Kir6.2 subunit of the ATP-sensitive potassium channel, vital for glucose-stimulated insulin secretion. Engineered with both U6 and miR30-based shRNA, this tool helps researchers study the mechanisms of hyperinsulinemia and neonatal diabetes. Multiple AAV serotypes are available to ensure precise delivery. Every batch undergoes comprehensive quality control, covering functional titer, sequence verification, and the total absence of pathogens.
Production Cell Line: HEK293
AAV ITR: AAV2 ITR
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: The sequence identity and genomic integrity of all preparations were successfully confirmed via sequencing and PCR validation.
Sterility Test: Stringent QC assays have verified the sterility of this product lot, ensuring it is free of all detectable microbial contaminants.
Mycoplasma Test: Confirmed free of mycoplasma contamination via high-sensitivity QC assays; this product lot has successfully passed the production safety protocols.
Other QC: Tailored supplementary testing and transduction performance assays are available to evaluate gene silencing at the molecular level. We provide comprehensive in vitro and in vivo assessments to elucidate the impact of shRNA-targeted editing on gene expression profiles and downstream biological phenotypes.
Storage: To maintain optimal viral potency and structural integrity, it is essential to store the vector at -80°C immediately following its receipt.
Stability: Long-term storage at -80°C ensures product integrity for up to 24 months. For immediate experimental use, the thawed viral preparations are refrigerated at 4°C, maintaining robust performance for a period of 2–3 weeks.
Shipping Condition: Shipped on dry ice. Product integrity is guaranteed through temperature-controlled logistics for all viral vector types.
Handling Notes: To prevent titer loss caused by repeated freeze-thaw cycles, we recommend aliquoting the virus into single-use volumes upon receipt. Use low-protein-binding microcentrifuge tubes and store under specified conditions. Strict adherence to biosafety protocols is required; perform all handling within a designated biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: All products undergo stringent quality control; however, no warranty is provided for performance in specific applications, given the diversity of experimental variables. The user is ultimately responsible for ensuring proper storage, handling, and adherence to all local laws, biosafety standards, and safety regulations throughout the use of the product.

Target Profile

Gene Name: KCNJ11
Full Name: Potassium inwardly rectifying channel subfamily J member 11
Gene Symbol: BIR; HHF2; PHHI; IKATP; PNDM2; TNDM3; KIR6.2; MODY13
Gene ID: 3767
RefSeq ID-1: NP_000516.3
RefSeq ID-2: NM_000525.3
Summary: KCNJ11 encodes the Kir6.2 subunit of the ATP-sensitive potassium (K-ATP) channel found in pancreatic beta cells. This integral membrane protein couples the cell's metabolic state to its electrical activity; when blood glucose is high, the channel closes, triggering insulin release. Mutations in this gene can cause either permanent neonatal diabetes (if the channel stays open) or persistent hyperinsulinemic hypoglycemia (if it stays closed). Because it is the "gatekeeper" for insulin secretion, KCNJ11 is a fundamental factor in the development of non-insulin-dependent diabetes and is a primary target for sulfonylurea medications.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.