Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human GNAS shRNA Ad5 Particle (Silencing)

Cat. No.: V0126XX31
Species: Human
Target Gene: GNAS
Vector System: Adenovirus
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human GNAS shRNA Ad5 Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX31-1 TAAAGCCTTAAGCACAATTAA 3' UTR Inquiry
V0126XX31-2 CCTGCATGTTAATGGGTTTAA 3' UTR Inquiry
V0126XX31-3 TCACTACTGCTACCCTCATTT 3' UTR Inquiry
V0126XX31-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human GNAS shRNA Ad5 Particle (Silencing) is a sophisticated genetic tool designed for the robust knockdown of the GNAS complex locus, which encodes the stimulatory G-protein alpha subunit. This product is essential for investigating the molecular basis of pseudohypoparathyroidism and the role of imprinting defects in severe early-onset obesity. Our advanced platform utilizes high-titer Ad5 delivery of U6 or miR30-based shRNA systems to ensure maximum silencing efficiency. To guarantee optimal experimental reliability, every batch undergoes a comprehensive QC suite, including functional titration, sequence integrity verification, and negative testing for sterility and mycoplasma.
Production Cell Line: HEK293
Viral Backbone: Adenovirus type 5 (dE1/E3)
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: GNAS
Full Name: GNAS complex locus
Gene Symbol: AHO; GSA; GSP; POH; GPSA; NESP; SCG6; SgVI; GNAS1; PITA3; AIMAH1; C20orf45
Gene ID: 2778
RefSeq ID-1: NP_001070958.1
RefSeq ID-2: NM_001077490.3
Summary: GNAS is a highly complex imprinted locus that produces multiple transcripts expressed maternally, paternally, or biallelically. These transcripts originate from four alternative promoters and 5' exons, with some containing differentially methylated regions (DMRs) that influence gene expression. The locus also produces antisense noncoding RNAs, which may regulate imprinting, and one transcript contains an overlapping open reading frame encoding the unrelated protein Alex. Alternative splicing generates different forms of the stimulatory G-protein alpha subunit, a key mediator linking receptor-ligand interactions to adenylyl cyclase activation and downstream cellular responses. Multiple isoforms have been identified. Mutations or imprinting defects in GNAS are associated with disorders including pseudohypoparathyroidism types 1a/1b, Albright hereditary osteodystrophy, McCune-Albright syndrome, progressive osseous heteroplasia, polyostotic fibrous dysplasia, and some pituitary tumors. Notably, GNAS defects have been increasingly recognized as a cause of isolated monogenic obesity, likely through disrupted hypothalamic signaling that controls energy balance.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.