Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human ADRB3 shRNA Ad5 Particle (Silencing)
Cat. No.:
V0126XX10
Species:
Human
Target Gene:
ADRB3
Vector System:
Adenovirus
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX10-1 | TATCTCTGGTTCCCTTATTAC | 3' UTR | Inquiry |
| V0126XX10-2 | ACTGGCTAGGTTATGCCAATT | CDS | Inquiry |
| V0126XX10-3 | CAGTGGCCTCTCTCACTTTAG | 3' UTR | Inquiry |
| V0126XX10-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human ADRB3 shRNA Ad5 Particle (Silencing) targets the ADRB3, a key player in lipolysis and thermogenesis within brown and white adipose tissues. This Ad5-mediated RNAi tool is ideal for exploring the sympathetic control of fat metabolism and its failure in obesity. Each viral preparation is subjected to total QC verification—covering sequence identity, functional activity, and microbial safety—to ensure that your results are both safe and scientifically sound.
Production Cell Line:
HEK293
Viral Backbone:
Adenovirus type 5 (dE1/E3)
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test:
This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test:
This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC:
Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage:
Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability:
This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition:
All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes:
Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.
Target Profile
Gene Name:
ADRB3
Full Name:
Adrenoceptor beta 3
Gene Symbol:
BETA3AR
Gene ID:
155
RefSeq ID-1:
NP_000016.1
RefSeq ID-2:
NM_000025.3
Summary:
The ADRB3 gene encodes the beta-adrenergic receptor 3, a member of the G protein-coupled receptor family. Primarily localized in adipose tissue, it regulates lipolysis and non-shivering thermogenesis by mediating catecholamine signaling and activating adenylate cyclase. ADRB3 serves as a key regulator of energy expenditure. Certain polymorphisms in this gene are associated with obesity and weight-related disorders, making it a potential target for studying metabolic disorders and developing weight-loss medications.
Related Products
-
AdipoUpX™ Human PDK4 Ad5 Particle (Overexpression)
-
AdipoUpX™ Human MGLL Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human CD36 shRNA Ad5 Particle (Silencing)
-
AdipoUpX™ Human STAT1 Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human SDCCAG8 shRNA Ad5 Particle (Silencing)
-
AdipoUpX™ Human BBS10 Ad5 Particle (Overexpression)