Inquiry
Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human ACAT2 shRNA AAV Particle (Silencing)

Cat. No.: V0126XX361
Species: Human
Target Gene: ACAT2
Vector System: AAV
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human ACAT2 shRNA AAV Particle (Silencing)
INQUIRY Datasheet MSDS
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. AAV Serotype Tissue Tropism TargetSeq Region Inquiry
V0126XX361-1 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CTGGAAGATGTTGACATATTT CDS Inquiry
V0126XX361-2 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle AGAAGTCAGAAGCTGATAAAC CDS Inquiry
V0126XX361-3 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle TAAACCCAGAGAAGGTCAATA CDS Inquiry
V0126XX361-4 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CTGGAAGATGTTGACATATTT CDS Inquiry
V0126XX361-5 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle AGAAGTCAGAAGCTGATAAAC CDS Inquiry
V0126XX361-6 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle TAAACCCAGAGAAGGTCAATA CDS Inquiry
V0126XX361-7 AAV3 Lung; Liver; Smooth muscle CTGGAAGATGTTGACATATTT CDS Inquiry
V0126XX361-8 AAV3 Lung; Liver; Smooth muscle AGAAGTCAGAAGCTGATAAAC CDS Inquiry
V0126XX361-9 AAV3 Lung; Liver; Smooth muscle TAAACCCAGAGAAGGTCAATA CDS Inquiry
V0126XX361-10 AAV4 CNS; Retina; Heart; Lung; Kidney CTGGAAGATGTTGACATATTT CDS Inquiry
V0126XX361-11 AAV4 CNS; Retina; Heart; Lung; Kidney AGAAGTCAGAAGCTGATAAAC CDS Inquiry
V0126XX361-12 AAV4 CNS; Retina; Heart; Lung; Kidney TAAACCCAGAGAAGGTCAATA CDS Inquiry
V0126XX361-13 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CTGGAAGATGTTGACATATTT CDS Inquiry
V0126XX361-14 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle AGAAGTCAGAAGCTGATAAAC CDS Inquiry
V0126XX361-15 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle TAAACCCAGAGAAGGTCAATA CDS Inquiry
V0126XX361-16 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CTGGAAGATGTTGACATATTT CDS Inquiry
V0126XX361-17 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle AGAAGTCAGAAGCTGATAAAC CDS Inquiry
V0126XX361-18 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle TAAACCCAGAGAAGGTCAATA CDS Inquiry
V0126XX361-19 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CTGGAAGATGTTGACATATTT CDS Inquiry
V0126XX361-20 AAV7 CNS; Brain; Retina; Liver; Smooth muscle AGAAGTCAGAAGCTGATAAAC CDS Inquiry
V0126XX361-21 AAV7 CNS; Brain; Retina; Liver; Smooth muscle TAAACCCAGAGAAGGTCAATA CDS Inquiry
V0126XX361-22 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CTGGAAGATGTTGACATATTT CDS Inquiry
V0126XX361-23 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle AGAAGTCAGAAGCTGATAAAC CDS Inquiry
V0126XX361-24 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle TAAACCCAGAGAAGGTCAATA CDS Inquiry
V0126XX361-25 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CTGGAAGATGTTGACATATTT CDS Inquiry
V0126XX361-26 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle AGAAGTCAGAAGCTGATAAAC CDS Inquiry
V0126XX361-27 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle TAAACCCAGAGAAGGTCAATA CDS Inquiry
V0126XX361-28 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human ACAT2 shRNA AAV Particle (Silencing) is designed to target ACAT2, a key enzyme in cholesterol esterification and hepatic lipid metabolism. Our platform utilizes both high-potency U6-driven shRNA and physiologically refined miR30-based architectures to allow for precise modulation of lipid synthesis pathways. To ensure optimal in vivo delivery, we provide a wide range of AAV serotypes (AAV2, AAV8, AAV9, etc.), all supported by rigorous quality control, including functional titer, sterility, and mycoplasma testing for maximum experimental reliability.
Production Cell Line: HEK293
AAV ITR: AAV2 ITR
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: The sequence identity and genomic integrity of all preparations were successfully confirmed via sequencing and PCR validation.
Sterility Test: Stringent QC assays have verified the sterility of this product lot, ensuring it is free of all detectable microbial contaminants.
Mycoplasma Test: Confirmed free of mycoplasma contamination via high-sensitivity QC assays; this product lot has successfully passed the production safety protocols.
Other QC: Tailored supplementary testing and transduction performance assays are available to evaluate gene silencing at the molecular level. We provide comprehensive in vitro and in vivo assessments to elucidate the impact of shRNA-targeted editing on gene expression profiles and downstream biological phenotypes.
Storage: To maintain optimal viral potency and structural integrity, it is essential to store the vector at -80°C immediately following its receipt.
Stability: Long-term storage at -80°C ensures product integrity for up to 24 months. For immediate experimental use, the thawed viral preparations are refrigerated at 4°C, maintaining robust performance for a period of 2–3 weeks.
Shipping Condition: Shipped on dry ice. Product integrity is guaranteed through temperature-controlled logistics for all viral vector types.
Handling Notes: To prevent titer loss caused by repeated freeze-thaw cycles, we recommend aliquoting the virus into single-use volumes upon receipt. Use low-protein-binding microcentrifuge tubes and store under specified conditions. Strict adherence to biosafety protocols is required; perform all handling within a designated biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: All products undergo stringent quality control; however, no warranty is provided for performance in specific applications, given the diversity of experimental variables. The user is ultimately responsible for ensuring proper storage, handling, and adherence to all local laws, biosafety standards, and safety regulations throughout the use of the product.

Target Profile

Gene Name: ACAT2
Full Name: Acetyl-CoA acetyltransferase 2
Gene ID: 39
RefSeq ID-1: NP_001290182.1
RefSeq ID-2: NM_001303253.1
Summary: ACAT2 encodes cytosolic acetoacetyl-CoA thiolase, an essential enzyme in lipid metabolism. It is involved in the metabolic pathways that handle ketone bodies and fatty acid fragments within the cytoplasm. Interestingly, the gene overlaps with the 3-prime region of the TCP1 gene on the opposite DNA strand, suggesting a complex genomic architecture that may influence its regulation across different species.

Related Products

Inquiry
0
Inquiry Basket

Recognizing the multifaceted nature of obesity, we leverage our expertise in preclinical research to provide tailored solutions that address the unique challenges faced by our partners in the biotechnology and pharmaceutical industries.

By Molecule Type

By Products

By Services

Contact Us

Copyright © Protheragen. All rights reserves.