LipoKnoxa™ Human UCP3 shRNA Ad5 Particle (Silencing)

Cat. No.: V0126XX7

Species: Human

Target Gene: UCP3

Vector System: Adenovirus

Modulation Type: Silencing (shRNA)

LipoKnoxa™ Human UCP3 shRNA Ad5 Particle (Silencing)

INQUIRY Datasheet MSDS

Sub Cat. No.	TargetSeq	Region	Inquiry
V0126XX7-1	CCGTGAAATCTGGTTAGATAA	3' UTR	Inquiry
V0126XX7-2	CGTGGTGAAGACCCGGTATAT	CDS	Inquiry
V0126XX7-3	TGATGAAAGTCCAGATGTTAC	CDS	Inquiry
V0126XX7-4	Other		Inquiry

Product Overview

Description: LipoKnoxa™ Human UCP3 shRNA Ad5 Particle (Silencing) is designed to reduce UCP3 levels, allowing for the study of its impact on thermogenesis and fatty acid metabolism in skeletal muscle. Utilizing a proven U6-driven shRNA system, this tool helps clarify the role of mitochondrial uncoupling in obesity-related metabolic inefficiency. Strict quality control protocols, including mycoplasma and sequence verification, are applied to every batch to ensure the highest level of biosafety and experimental precision.

Production Cell Line: HEK293

Viral Backbone: Adenovirus type 5 (dE1/E3)

Promoter: U6; CMV; EF1α; CAG; UBC

Product Availability: Produced Upon Order

Specification

Titer Test: qPCR

Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.

Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.

Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.

Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.

Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.

Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.

Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.

Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.

Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.

Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: UCP3

Full Name: Uncoupling protein 3

Gene Symbol: SLC25A9

Gene ID: 7352

RefSeq ID-1: NP_003347.1

RefSeq ID-2: NM_003356.4

Summary: The UCP3 gene encodes mitochondrial uncoupling protein 3, a member of the mitochondrial anion carrier protein family. The key function of UCP3 is to promote the uncoupling of oxidative phosphorylation from ATP synthesis, dissipating energy as heat—a process termed “mitochondrial proton leakage.” Primarily expressed in skeletal muscle, this protein is thought to protect mitochondria from lipid-induced oxidative stress. UCP3 activity is regulated by fatty acid supply, making it a crucial molecular target for studying thermogenesis mechanisms and metabolic rates.

Related Products

Inquiry

Inquiry Basket

Delete selected Check Out