Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human TUB shRNA Ad5 Particle (Silencing)
Cat. No.:
V0126XX52
Species:
Human
Target Gene:
TUB
Vector System:
Adenovirus
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX52-1 | GCAGGACATTTACCTCTTAAA | 3' UTR | Inquiry |
| V0126XX52-2 | GCATTTGATTTCTCCAGGTTT | 3' UTR | Inquiry |
| V0126XX52-3 | GAATAAGAACACGGAGAGTAT | CDS | Inquiry |
| V0126XX52-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human TUB shRNA Ad5 Particle (Silencing) targets the human TUB gene, whose mutations are historically linked to maturity-onset obesity and insulin resistance. This Ad5-mediated knockdown tool enables the exploration of ciliary signaling and vesicle trafficking in hypothalamic neurons. Our customizable platform supports flexible reporter gene inclusion and maintains strict quality control oversight—covering sequence accuracy and microbial contaminants—to provide a reliable technical foundation for longitudinal metabolic studies.
Production Cell Line:
HEK293
Viral Backbone:
Adenovirus type 5 (dE1/E3)
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test:
This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test:
This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC:
Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage:
Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability:
This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition:
All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes:
Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.
Target Profile
Gene Name:
TUB
Full Name:
TUB bipartite transcription factor
Gene Symbol:
rd5; RDOB
Gene ID:
7275
RefSeq ID-1:
NP_003311.2
RefSeq ID-2:
NM_003320.4
Summary:
TUB encodes a member of the Tubby family of bipartite transcription factors, which have been implicated in the regulation of body weight and sensory neuron function. The protein acts as a membrane-associated transcription regulator that translocates to the nucleus in response to phosphoinositide signaling. Studies suggest that disruption of TUB function contributes to obesity and neurodegeneration. Two alternatively spliced transcript variants encoding distinct isoforms have been identified.
Related Products
-
LipoKnoxa™ Human PLIN2 shRNA Ad5 Particle (Silencing)
-
AdipoUpX™ Human NR0B2 Ad5 Particle (Overexpression)
-
AdipoUpX™ Human PPARG Ad5 Particle (Overexpression)
-
AdipoUpX™ Human TFAM Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human VPS13B shRNA Ad5 Particle (Silencing)
-
LipoKnoxa™ Human PRKACA shRNA Ad5 Particle (Silencing)