Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human RAB23 shRNA Ad5 Particle (Silencing)
Cat. No.:
V0126XX137
Species:
Human
Target Gene:
RAB23
Vector System:
Adenovirus
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX137-1 | TACATTGTGCAATGCATTAAG | 3' UTR | Inquiry |
| V0126XX137-2 | GAGCGACAAATTCAAGTTAAT | CDS | Inquiry |
| V0126XX137-3 | AGGAGGAATTTGATGCAATTA | CDS | Inquiry |
| V0126XX137-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human RAB23 shRNA Ad5 Particle (Silencing) targets a member of the rab family of small GTPases that acts as a negative regulator of the Hedgehog signaling pathway. Deficiency in RAB23 is linked to Carpenter syndrome and morbid obesity. By reducing expression via specialized U6 or miR30 shRNA systems, this tool helps researchers understand the intersection of ciliary protein sorting and adipocyte development. All particles are screened through exhaustive QC screening to ensure optimal reliability and microbial safety.
Production Cell Line:
HEK293
Viral Backbone:
Adenovirus type 5 (dE1/E3)
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test:
This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test:
This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC:
Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage:
Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability:
This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition:
All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes:
Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.
Target Profile
Gene Name:
RAB23
Full Name:
RAB23, member RAS oncogene family
Gene Symbol:
HSPC137
Gene ID:
51715
RefSeq ID-1:
NP_001265595.1
RefSeq ID-2:
NM_001278666.2
Summary:
RAB23 is a small GTPase involved in the regulation of intracellular membrane trafficking and protein transport. It is particularly noted for its role in the central nervous system, where it acts as a negative regulator of the Sonic Hedgehog signaling pathway. Genetic disruptions of RAB23 contribute to Carpenter syndrome, which involves complex physical malformations and increased obesity risk.
Related Products
-
AdipoUpX™ Human CEBPA Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human IL10 shRNA Ad5 Particle (Silencing)
-
LipoKnoxa™ Human CLMP shRNA Ad5 Particle (Silencing)
-
AdipoUpX™ Human IRX3 Ad5 Particle (Overexpression)
-
AdipoUpX™ Human CPE Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human PIK3CA shRNA Ad5 Particle (Silencing)