Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human PDE3B shRNA Ad5 Particle (Silencing)

Cat. No.: V0126XX199
Species: Human
Target Gene: PDE3B
Vector System: Adenovirus
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human PDE3B shRNA Ad5 Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX199-1 GCATCAAACTGGCAGATATAA CDS Inquiry
V0126XX199-2 TGTTGCAGAGCCCTTACTTAA 3' UTR Inquiry
V0126XX199-3 GCGTCAGCTTGGAATCTATAT CDS Inquiry
V0126XX199-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human CLMP shRNA Ad5 Particle (Silencing) targets the CXADR-like membrane protein, which has been identified as a genetic modifier of adipocyte differentiation and fat mass expansion. Silencing CLMP via our optimized shRNA platforms (U6 or miR30) allows researchers to investigate the role of cell adhesion-like molecules in white adipose tissue remodeling. Our quality system ensures viral potency and sterility, providing a reliable technical foundation for complex signaling experiments through validated QC oversight and functional titering.
Production Cell Line: HEK293
Viral Backbone: Adenovirus type 5 (dE1/E3)
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: PDE3B
Full Name: Phosphodiesterase 3B
Gene Symbol: HcGIP1; cGIPDE1
Gene ID: 5140
RefSeq ID-1: NP_000913.2
RefSeq ID-2: NM_000922.3
Summary: PDE3B encodes a membrane-associated phosphodiesterase that hydrolyzes cyclic AMP (cAMP), thereby modulating intracellular signaling pathways. It participates in the regulation of lipid catabolism, angiogenesis, and PI3K–AKT signaling. In adipocytes, PDE3B plays a critical role in insulin-mediated suppression of lipolysis, making it an important regulator of fat storage and energy balance in obesity. The protein functions as part of a guanyl nucleotide exchange factor complex.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.