Inquiry
Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human LZTFL1 shRNA AAV Particle (Silencing)

Cat. No.: V0126XX283
Species: Human
Target Gene: LZTFL1
Vector System: AAV
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human LZTFL1 shRNA AAV Particle (Silencing)
INQUIRY Datasheet MSDS
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. AAV Serotype Tissue Tropism TargetSeq Region Inquiry
V0126XX283-1 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle TTAGAACTAGAGTTCCTATTT 3' UTR Inquiry
V0126XX283-2 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle TGGAACAGCAGAACTCCTAAA CDS Inquiry
V0126XX283-3 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle GCCTATACCAATGTGTTACTT CDS Inquiry
V0126XX283-4 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle TTAGAACTAGAGTTCCTATTT 3' UTR Inquiry
V0126XX283-5 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle TGGAACAGCAGAACTCCTAAA CDS Inquiry
V0126XX283-6 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle GCCTATACCAATGTGTTACTT CDS Inquiry
V0126XX283-7 AAV3 Lung; Liver; Smooth muscle TTAGAACTAGAGTTCCTATTT 3' UTR Inquiry
V0126XX283-8 AAV3 Lung; Liver; Smooth muscle TGGAACAGCAGAACTCCTAAA CDS Inquiry
V0126XX283-9 AAV3 Lung; Liver; Smooth muscle GCCTATACCAATGTGTTACTT CDS Inquiry
V0126XX283-10 AAV4 CNS; Retina; Heart; Lung; Kidney TTAGAACTAGAGTTCCTATTT 3' UTR Inquiry
V0126XX283-11 AAV4 CNS; Retina; Heart; Lung; Kidney TGGAACAGCAGAACTCCTAAA CDS Inquiry
V0126XX283-12 AAV4 CNS; Retina; Heart; Lung; Kidney GCCTATACCAATGTGTTACTT CDS Inquiry
V0126XX283-13 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle TTAGAACTAGAGTTCCTATTT 3' UTR Inquiry
V0126XX283-14 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle TGGAACAGCAGAACTCCTAAA CDS Inquiry
V0126XX283-15 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle GCCTATACCAATGTGTTACTT CDS Inquiry
V0126XX283-16 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle TTAGAACTAGAGTTCCTATTT 3' UTR Inquiry
V0126XX283-17 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle TGGAACAGCAGAACTCCTAAA CDS Inquiry
V0126XX283-18 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle GCCTATACCAATGTGTTACTT CDS Inquiry
V0126XX283-19 AAV7 CNS; Brain; Retina; Liver; Smooth muscle TTAGAACTAGAGTTCCTATTT 3' UTR Inquiry
V0126XX283-20 AAV7 CNS; Brain; Retina; Liver; Smooth muscle TGGAACAGCAGAACTCCTAAA CDS Inquiry
V0126XX283-21 AAV7 CNS; Brain; Retina; Liver; Smooth muscle GCCTATACCAATGTGTTACTT CDS Inquiry
V0126XX283-22 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle TTAGAACTAGAGTTCCTATTT 3' UTR Inquiry
V0126XX283-23 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle TGGAACAGCAGAACTCCTAAA CDS Inquiry
V0126XX283-24 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle GCCTATACCAATGTGTTACTT CDS Inquiry
V0126XX283-25 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle TTAGAACTAGAGTTCCTATTT 3' UTR Inquiry
V0126XX283-26 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle TGGAACAGCAGAACTCCTAAA CDS Inquiry
V0126XX283-27 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle GCCTATACCAATGTGTTACTT CDS Inquiry
V0126XX283-28 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human LZTFL1 shRNA AAV Particle (Silencing) focuses on the targeted inhibition of LZTFL1, a key player in ciliary protein trafficking and Bardet-Biedl Syndrome. We provide two distinct expression strategies—U6-driven shRNA for maximal depth and miR30-based shRNA for reduced off-target effects. Multiple AAV serotypes are available to facilitate tissue-specific delivery. To ensure experimental success, every preparation undergoes total QC verification, including functional titer and sterility testing.
Production Cell Line: HEK293
AAV ITR: AAV2 ITR
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: The sequence identity and genomic integrity of all preparations were successfully confirmed via sequencing and PCR validation.
Sterility Test: Stringent QC assays have verified the sterility of this product lot, ensuring it is free of all detectable microbial contaminants.
Mycoplasma Test: Confirmed free of mycoplasma contamination via high-sensitivity QC assays; this product lot has successfully passed the production safety protocols.
Other QC: Tailored supplementary testing and transduction performance assays are available to evaluate gene silencing at the molecular level. We provide comprehensive in vitro and in vivo assessments to elucidate the impact of shRNA-targeted editing on gene expression profiles and downstream biological phenotypes.
Storage: To maintain optimal viral potency and structural integrity, it is essential to store the vector at -80°C immediately following its receipt.
Stability: Long-term storage at -80°C ensures product integrity for up to 24 months. For immediate experimental use, the thawed viral preparations are refrigerated at 4°C, maintaining robust performance for a period of 2–3 weeks.
Shipping Condition: Shipped on dry ice. Product integrity is guaranteed through temperature-controlled logistics for all viral vector types.
Handling Notes: To prevent titer loss caused by repeated freeze-thaw cycles, we recommend aliquoting the virus into single-use volumes upon receipt. Use low-protein-binding microcentrifuge tubes and store under specified conditions. Strict adherence to biosafety protocols is required; perform all handling within a designated biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: All products undergo stringent quality control; however, no warranty is provided for performance in specific applications, given the diversity of experimental variables. The user is ultimately responsible for ensuring proper storage, handling, and adherence to all local laws, biosafety standards, and safety regulations throughout the use of the product.

Target Profile

Gene Name: LZTFL1
Full Name: Leucine zipper transcription factor like 1
Gene Symbol: BBS17
Gene ID: 54585
RefSeq ID-1: NP_001263307.1
RefSeq ID-2: NM_001276378.2
Summary: LZTFL1 encodes a cytoplasmic protein that serves as a key regulator for the BBSome complex. By interacting with Bardet-Biedl Syndrome (BBS) proteins, it manages the trafficking of signaling molecules to the primary cilium. Mutations in LZTFL1 cause a form of Bardet-Biedl Syndrome, a ciliopathy defined by morbid obesity, polydactyly, and kidney failure. Additionally, it may act as a tumor suppressor by regulating the transition of cells between epithelial and mesenchymal states through interaction with the actin cytoskeleton.

Related Products

Inquiry
0
Inquiry Basket

Recognizing the multifaceted nature of obesity, we leverage our expertise in preclinical research to provide tailored solutions that address the unique challenges faced by our partners in the biotechnology and pharmaceutical industries.

By Molecule Type

By Products

By Services

Contact Us

Copyright © Protheragen. All rights reserves.