Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human ATF6 shRNA Ad5 Particle (Silencing)

Cat. No.: V0126XX191
Species: Human
Target Gene: ATF6
Vector System: Adenovirus
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human ATF6 shRNA Ad5 Particle (Silencing)
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. TargetSeq Region Inquiry
V0126XX191-1 ACAGAGTCTCTCAGGTTAAAT CDS Inquiry
V0126XX191-2 GATGATAGTATTGGCATTTAT CDS Inquiry
V0126XX191-3 CAATTGTGTTACCAGCAATAA CDS Inquiry
V0126XX191-4 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human STEAP4 shRNA Ad5 Particle (Silencing) is specifically developed to suppress the expression of the metalloreductase STEAP4 (also known as TIARP), a key modulator of inflammatory signaling and glucose metabolism in adipocytes. By utilizing an advanced shRNA platform incorporating U6 or miR30-based systems, researchers can effectively study how STEAP4 deficiency impacts insulin sensitivity and mitochondrial function in adipocytes and other cells. Every batch is subjected to a comprehensive QC suite, including high-precision functional titering and rigorous testing for sterility and mycoplasma, ensuring the highest standards of biosafety and experimental reproducibility.
Production Cell Line: HEK293
Viral Backbone: Adenovirus type 5 (dE1/E3)
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test: This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test: This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC: Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage: Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability: This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition: All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes: Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.

Target Profile

Gene Name: ATF6
Full Name: Activating transcription factor 6
Gene Symbol: ACHM7; ATF6A; ATP6alpha
Gene ID: 22926
RefSeq ID-1: NP_031374.2
RefSeq ID-2: NM_007348.4
Summary: ATF6 encodes an endoplasmic reticulum–resident transcription factor that plays a pivotal role in coordinating the unfolded protein response (UPR) under conditions of ER stress. Unlike classical transcription factors, ATF6 is synthesized as a type I transmembrane protein embedded in the ER membrane, where it functions as a stress sensor and signal transducer. Upon ER stress, ATF6 undergoes regulated intramembrane proteolysis, releasing an active fragment that migrates to the nucleus and binds ER stress response elements (ERSEs) within promoters of ER chaperone genes. Dysregulated ER stress signaling is a key feature of obesity-associated metabolic tissues, linking ATF6 activity to insulin resistance and lipid imbalance. Genetic variants in ATF6 have shown population-dependent associations with diabetes, while other polymorphisms correlate with elevated plasma cholesterol. ATF6 has also been described as a survival factor in quiescent squamous carcinoma cells and represents a potential therapeutic target for cystic fibrosis.
Inquiry
0
Inquiry Basket

Copyright © Protheragen. All rights reserves.