Inquiry
Products
Online Inquiry

Please note that we are not a pharmacy or clinic, so we are unable to see patients and do not offer diagnostic and treatment services for individuals.

Vitamin B12 test kit

LipoKnoxa™ Human AKT1 shRNA AAV Particle (Silencing)

Cat. No.: V0126XX309
Species: Human
Target Gene: AKT1
Vector System: AAV
Modulation Type: Silencing (shRNA)
LipoKnoxa™ Human AKT1 shRNA AAV Particle (Silencing)
INQUIRY Datasheet MSDS
SPECIFIC INQUIRY
Fluorescent Reporters:
Titer:
Size:
Add to basket
Sub Cat. No. AAV Serotype Tissue Tropism TargetSeq Region Inquiry
V0126XX309-1 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CGTGCCATGATCTGTATTTAA 3' UTR Inquiry
V0126XX309-2 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle GGACAAGGACGGGCACATTAA CDS Inquiry
V0126XX309-3 AAV1 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Skeletal muscle; Smooth muscle CGCGTGACCATGAACGAGTTT CDS Inquiry
V0126XX309-4 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CGTGCCATGATCTGTATTTAA 3' UTR Inquiry
V0126XX309-5 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle GGACAAGGACGGGCACATTAA CDS Inquiry
V0126XX309-6 AAV2 CNS; Brain; Retina; Inner ear; Kidney; Testes; Liver; Pancreas; Smooth muscle CGCGTGACCATGAACGAGTTT CDS Inquiry
V0126XX309-7 AAV3 Lung; Liver; Smooth muscle CGTGCCATGATCTGTATTTAA 3' UTR Inquiry
V0126XX309-8 AAV3 Lung; Liver; Smooth muscle GGACAAGGACGGGCACATTAA CDS Inquiry
V0126XX309-9 AAV3 Lung; Liver; Smooth muscle CGCGTGACCATGAACGAGTTT CDS Inquiry
V0126XX309-10 AAV4 CNS; Retina; Heart; Lung; Kidney CGTGCCATGATCTGTATTTAA 3' UTR Inquiry
V0126XX309-11 AAV4 CNS; Retina; Heart; Lung; Kidney GGACAAGGACGGGCACATTAA CDS Inquiry
V0126XX309-12 AAV4 CNS; Retina; Heart; Lung; Kidney CGCGTGACCATGAACGAGTTT CDS Inquiry
V0126XX309-13 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CGTGCCATGATCTGTATTTAA 3' UTR Inquiry
V0126XX309-14 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle GGACAAGGACGGGCACATTAA CDS Inquiry
V0126XX309-15 AAV5 CNS; Brain; Retina; Heart; Lung; Smooth muscle CGCGTGACCATGAACGAGTTT CDS Inquiry
V0126XX309-16 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CGTGCCATGATCTGTATTTAA 3' UTR Inquiry
V0126XX309-17 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle GGACAAGGACGGGCACATTAA CDS Inquiry
V0126XX309-18 AAV6 Heart; Lung; Liver; Pancreas; Adipose; Smooth muscle CGCGTGACCATGAACGAGTTT CDS Inquiry
V0126XX309-19 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CGTGCCATGATCTGTATTTAA 3' UTR Inquiry
V0126XX309-20 AAV7 CNS; Brain; Retina; Liver; Smooth muscle GGACAAGGACGGGCACATTAA CDS Inquiry
V0126XX309-21 AAV7 CNS; Brain; Retina; Liver; Smooth muscle CGCGTGACCATGAACGAGTTT CDS Inquiry
V0126XX309-22 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CGTGCCATGATCTGTATTTAA 3' UTR Inquiry
V0126XX309-23 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle GGACAAGGACGGGCACATTAA CDS Inquiry
V0126XX309-24 AAV8 CNS; Brain; Retina; Inner ear; Heart; Liver; Pancreas; Kidney; Adipose; Smooth muscle CGCGTGACCATGAACGAGTTT CDS Inquiry
V0126XX309-25 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CGTGCCATGATCTGTATTTAA 3' UTR Inquiry
V0126XX309-26 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle GGACAAGGACGGGCACATTAA CDS Inquiry
V0126XX309-27 AAV9 CNS; Brain; Retina; Inner ear; Heart; Lung; Liver; Pancreas; Kidney; Testes; Adipose; Skeletal muscle; Smooth muscle CGCGTGACCATGAACGAGTTT CDS Inquiry
V0126XX309-28 Other Inquiry

Product Overview

Description: LipoKnoxa™ Human AKT1 shRNA AAV Particle (Silencing) facilitates the long-term knockdown of AKT1 to investigate its role in cell survival and growth in metabolic tissues. Developed using optimized U6 and miR30-based shRNA frameworks, this tool allows researchers to dissect insulin-independent growth pathways. Our system offers multiple AAV serotypes for tissue-specific tropism. Comprehensive quality control, including high-precision titering and sterility testing, is performed on all particles.
Production Cell Line: HEK293
AAV ITR: AAV2 ITR
Promoter: U6; CMV; EF1α; CAG; UBC
Product Availability: Produced Upon Order

Specification

Titer Test: qPCR
Insert Verification: The sequence identity and genomic integrity of all preparations were successfully confirmed via sequencing and PCR validation.
Sterility Test: Stringent QC assays have verified the sterility of this product lot, ensuring it is free of all detectable microbial contaminants.
Mycoplasma Test: Confirmed free of mycoplasma contamination via high-sensitivity QC assays; this product lot has successfully passed the production safety protocols.
Other QC: Tailored supplementary testing and transduction performance assays are available to evaluate gene silencing at the molecular level. We provide comprehensive in vitro and in vivo assessments to elucidate the impact of shRNA-targeted editing on gene expression profiles and downstream biological phenotypes.
Storage: To maintain optimal viral potency and structural integrity, it is essential to store the vector at -80°C immediately following its receipt.
Stability: Long-term storage at -80°C ensures product integrity for up to 24 months. For immediate experimental use, the thawed viral preparations are refrigerated at 4°C, maintaining robust performance for a period of 2–3 weeks.
Shipping Condition: Shipped on dry ice. Product integrity is guaranteed through temperature-controlled logistics for all viral vector types.
Handling Notes: To prevent titer loss caused by repeated freeze-thaw cycles, we recommend aliquoting the virus into single-use volumes upon receipt. Use low-protein-binding microcentrifuge tubes and store under specified conditions. Strict adherence to biosafety protocols is required; perform all handling within a designated biosafety cabinet.
Intended Use: This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer: All products undergo stringent quality control; however, no warranty is provided for performance in specific applications, given the diversity of experimental variables. The user is ultimately responsible for ensuring proper storage, handling, and adherence to all local laws, biosafety standards, and safety regulations throughout the use of the product.

Target Profile

Gene Name: AKT1
Full Name: AKT serine/threonine kinase 1
Gene Symbol: AKT; PKB; RAC; PRKBA; PKB-ALPHA; RAC-ALPHA
Gene ID: 207
RefSeq ID-1: NP_001014431.1
RefSeq ID-2: NM_001014431.2
Summary: AKT1 is a central signaling node that mediates cellular responses to insulin, growth factors, and nutrients. It is recruited to the cell membrane by products of the PI3K pathway and subsequently regulates metabolism, cell survival, and protein synthesis through the mTOR pathway. While AKT1 is a well-known oncogene associated with various cancers and tissue overgrowth (such as Proteus syndrome), its canonical role in metabolism is to promote glucose uptake and prevent cell death.

Related Products

Inquiry
0
Inquiry Basket

Recognizing the multifaceted nature of obesity, we leverage our expertise in preclinical research to provide tailored solutions that address the unique challenges faced by our partners in the biotechnology and pharmaceutical industries.

By Molecule Type

By Products

By Services

Contact Us

Copyright © Protheragen. All rights reserves.