Products
- Anti-Obesity Compound Library
- GPCR/G Protein-Targeted Compounds
- Immunology/Inflammation-Targeted Compounds
- JAK/STAT-Targeted Compounds
- MAPK-Targeted Compounds
- Membrane Transporter/Ion Channel-Targeted Compounds
- Metabolism-Targeted Compounds
- NF-κB-Targeted Compounds
- Microbiology/Virology-Targeted Compounds
- Neuronal Signaling-Targeted Compounds
- PI3K/Akt/mTOR-Targeted Compounds
- Oxidation-reduction-Targeted Compounds
- Proteases/Proteasome-Targeted Compounds
- Stem Cells/Wnt-Targeted Compounds
- Tyrosine Kinase/Adaptors-Targeted Compounds
- Ubiquitin-Targeted Compounds
Online Inquiry
LipoKnoxa™ Human ACLY shRNA Ad5 Particle (Silencing)
Cat. No.:
V0126XX192
Species:
Human
Target Gene:
ACLY
Vector System:
Adenovirus
Modulation Type:
Silencing (shRNA)
SPECIFIC INQUIRY
Add to basket
| Sub Cat. No. | TargetSeq | Region | Inquiry |
|---|---|---|---|
| V0126XX192-1 | GCCTCAAGATACTATACATTT | 3' UTR | Inquiry |
| V0126XX192-2 | CGTGAGAGCAATTCGAGATTA | CDS | Inquiry |
| V0126XX192-3 | CCTATGACTATGCCAAGACTA | CDS | Inquiry |
| V0126XX192-4 | Other | Inquiry |
Product Overview
Description:
LipoKnoxa™ Human TFAP2B shRNA Ad5 Particle (Silencing) targets the human TFAP2B gene, which is strongly associated with adipose tissue distribution and the risk of obesity-related type 2 diabetes. This Ad5-mediated knockdown tool allows researchers to dissect the transcriptional control of adipocytokine secretion and lipid storage through specialized U6 or miR30 shRNA delivery. Our customizable platform supports flexible reporter gene inclusion and maintains strict quality control oversight—covering sequence accuracy and microbial contaminants—to provide a reliable technical foundation for longitudinal metabolic research.
Production Cell Line:
HEK293
Viral Backbone:
Adenovirus type 5 (dE1/E3)
Promoter:
U6; CMV; EF1α; CAG; UBC
Product Availability:
Produced Upon Order
Specification
Titer Test:
qPCR
Insert Verification:
All viral preparations are validated via Sequencing and PCR to ensure 100% sequence identity and the structural integrity of the vector genomes.
Sterility Test:
This product has been certified sterile following comprehensive microbial growth analysis, confirming the absence of bacterial and fungal contamination.
Mycoplasma Test:
This product was certified negative for mycoplasma contamination following stringent QC analysis, ensuring the absence of all mycoplasmal agents.
Other QC:
Beyond standard protocols, we offer customized knockdown efficiency validation through in vitro and in vivo assessments. This includes precise analysis of mRNA/protein reduction and subsequent biological responses to ensure the functional potency of the shRNA-mediated gene silencing.
Storage:
Upon receipt, viral preparations should be immediately transferred to -80°C for long-term storage to ensure maximum stability and maintain product integrity.
Stability:
This product maintains excellent biological activity for 6–12 months (and up to 2 years in specific cases) when stored continuously at -80°C. Once thawed, the working solution remains stable for 2–3 weeks at 4°C without significant loss of viral potency.
Shipping Condition:
All viral preparations are shipped on dry ice to ensure maximum biological activity and stability during transit.
Handling Notes:
Viral particles are susceptible to temperature fluctuations and freeze-thaw cycles. To preserve functional titers, it is essential to aliquot the vector into low-protein-binding tubes immediately upon first thaw. To ensure experimental success and biological safety, all procedures must be conducted within a certified biosafety cabinet.
Intended Use:
This product is intended for research use only and is not for use in diagnosis or therapeutic applications.
Product Disclaimer:
While our products are committed to excellence through rigorous internal QC inspections, we cannot guarantee specific performance or experimental outcomes due to the inherent complexity of biological systems. Users assume full responsibility for product storage, handling, and strict compliance with all applicable safety protocols, biosafety requirements, and legal regulations during all operational processes.
Target Profile
Gene Name:
ACLY
Full Name:
ATP citrate lyase
Gene Symbol:
ACL; ATPCL; CLATP
Gene ID:
47
RefSeq ID-1:
NP_001087.2
RefSeq ID-2:
NM_001096.2
Summary:
ACLY encodes ATP citrate lyase, a cytosolic enzyme that catalyzes the ATP-dependent conversion of citrate and coenzyme A into acetyl-CoA and oxaloacetate. Structurally, the enzyme functions as a tetramer composed of four similar subunits. The acetyl-CoA generated by ACLY serves as a central metabolic intermediate that fuels lipogenesis and cholesterol biosynthesis, processes that are markedly enhanced in obesity and metabolic syndrome. Elevated ACLY activity promotes fatty acid synthesis in the liver and adipose tissue, contributing to lipid accumulation. In the nervous system, ACLY may also participate in acetylcholine production. Multiple alternatively spliced transcripts encoding distinct isoforms have been identified.
Related Products
-
AdipoUpX™ Human PLIN2 Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human FAS shRNA Ad5 Particle (Silencing)
-
AdipoUpX™ Human ANGPTL8 Ad5 Particle (Overexpression)
-
AdipoUpX™ Human CERS6 Ad5 Particle (Overexpression)
-
LipoKnoxa™ Human SORBS1 shRNA Ad5 Particle (Silencing)
-
LipoKnoxa™ Human GFRAL shRNA Ad5 Particle (Silencing)